homogentisate 1,2-dioxygenase (HGD) - downstream reference sequence


         .         .         .            .         .         . g.59342
ctcaataaacttgctggtgttctgtggacgta / gtgattggtcataatcaagtcttgatga c.*240

         .         .         .         .         .         .    g.59402
gacaaacctggcaggtcaggtcagtcttgctaagattgaaccaaggcccagggccctttg    c.*300

         .         .         .         .         .         .    g.59462
ccttgtggttggcctgaatgccttcattctaggagcacaagtccaggcatatactaggta    c.*360

         .         .         .         .         .         .    g.59522
tcacaagaccaggccataaggccaaacgttaagaccatgagctgagactggaggtatggc    c.*420

         .         .         .         .         .         .    g.59582
aaagctcttaggagccaatccagacatggggaaatttaggggatcatgagtgctccaaat    c.*480

         .         .         .         .         .         .    g.59642
atccagctttcaatcgatgaggaaccgggccaataggctgtctaatcttggtagtcacgt    c.*540

         .         .         .         .         .         .    g.59702
agcagccaatatgatgatactggagaagaacaccagccaccaagaagtaagaatcactcc    c.*600

         .         .         .         .         .         .    g.59762
ttttcttggggtgaccaactgtcccagtttgtgcaggactatatcaattttttcactgaa    c.*660

         .         .         .         .         .         .    g.59822
agacccacatcccaggaaacccctcagtcctggtcaaaccaggacagttagttaccctac    c.*720

         .         .         .         .         .         .    g.59882
ccttcactcatttatcaatccattcggtaaccacatgttgagtccttactaccagctaca    c.*780

         .         .         .         .         .         .    g.59942
gttgaagatgctgggaatgaagggttgaataaaaagaagcaggctgtccccttaaggagc    c.*840

         .         .         .         .         .         .    g.60002
tcacagtctggagagataagggccaaagaaaatcaaggcccgagtataaggccatgataa    c.*900

         .         .         .         .         .         .    g.60062
aaatttccactgtgtgaaaagctgtacctaccagttcccttcctatggtcagcatccctc    c.*960

         .         .         .         .         .         .    g.60122
ccagagcgctgggctgcccaagactttagatgtgagttgattagagtctcctggtgtgaa    c.*1020

         .         .         .         .         .         .    g.60182
aagacaggcaaatctgaacagaaatatgatggaaaatgatatttttcactacttcagttc    c.*1080

         .         .         .         .         .         .    g.60242
tgtactttgcacatttccccagctttgttgccatagtagcaattttgatatgctgctacc    c.*1140

         .         .         .         .         .         .    g.60302
aaattttcattcagtaagatgtagtgagagtcagctatgtgtcagggcctaaggattagg    c.*1200

         .         .         .         .         .         .    g.60362
attgccagataaaatatatgaggcccagttaaatttaaatttcagacaaaccacaaatag    c.*1260

         .         .         .         .         .         .    g.60422
tttttagtgtaagtatgtcctatgcaatacttggacattcttatgttaaaaaattattaa    c.*1320

         .         .         .         .         .         .    g.60482
tcgattacctgaaattctaatttaagtgggcatcctgtatttttatttgctaaatttggc    c.*1380

         .         .         .         .         .         .    g.60542
aatcctactaggggtaagtggtcaaggagataggcatggtcctgcccttaccaaggttac    c.*1440

         .         .         .         .         .         .    g.60602
attacagagagggagatgacatgacttccccctggagagatagcaaataaaataaataaa    c.*1500

         .         .         .         .         .         .    g.60662
taaataaataaataaataaataaataaataaatagagggagttcgagtgccgtggctcac    c.*1560

         .         .         .         .         .         .    g.60722
acctataatcccagcactttgagaggccaaagcgggcaaactgcctgaggccaagagttc    c.*1620

         .         .         .         .         .         .    g.60782
aagaccaacctgcccaacatggcgaaaccccatctctactaaaaacacaaaaattagcct    c.*1680

         .         .         .         .         .         .    g.60842
ggcatggtggcacatgtctgtaatcccagttacttgggggctgaggtatgagaaatgctt    c.*1740

         .         .         .         .         .         .    g.60902
gaaccctggtggcagatgtcgcagtgagccaagattgcaccactgcactccagcctggtt    c.*1800

         .         .         .         .         .         .    g.60962
gacagagcaagactctgtgtcaaaaaaagataataataaaataaagagagggagacaaca    c.*1860

         .         .         .         .         .         .    g.61022
aaataaacaaaaatattacaaactgtggaacgtgctgagaagaaatcaaacggggattga    c.*1920

         .         .         .         .         .         .    g.61082
tatggaataacaagtggtatgagctaggagagctctttcttcagaggaaggaaggtcttc    c.*1980

         .         .         .         .         .         .    g.61142
agtgaagatgtgactttaaccagacctaaaggataggaaggagcaagtcattggaagagc    c.*2040

         .         .         .         .         .         .    g.61202
ggggatggggagaggtgggaaggggagaagcattttaagaaaaagcctcatggattcaag    c.*2100

         .         .         .         .         .         .    g.61262
tgcctgaaagaggagtgaatgtggggtgcccaagaggaagctattgcgatagtccaagca    c.*2160

         .         .         .         .         .              g.61314
aaaataaaccttgtcctgaactaatgaggtagcagcagagacagaagtggat            c.*2212


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center