homogentisate 1,2-dioxygenase (HGD) - 6233 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5445
gtaagaaaccatctgacaagtttgctatggcttcttcagccaaaatttatggaagtttct  c.15+60

         .         .         .         .         .         .  g.5505
gagaacttcagggtatcagagttggaaaagacttagagaggccctggttcaaacccctgt  c.15+120

         .         .         .         .         .         .  g.5565
gttcagaggcttccctgtggtgtctgtgggcacagctggagctgaagaacaagggaaagg  c.15+180

         .         .         .         .         .         .  g.5625
tgataaaggaaagaaatgaagctcttattggtcatcccttgcctttgttcatttcaatta  c.15+240

         .         .         .         .         .         .  g.5685
ttgtcttggaaatctgtagacatcctaagagctcccctccactacggacatgcacgtttc  c.15+300

         .         .         .         .         .         .  g.5745
tctctatgtctttttcccaacccctgctctgacaccttcccattgctgcagcctcatgga  c.15+360

         .         .         .         .         .         .  g.5805
ccacttccggtgaccagttagatatgcttgatctatttagttaattaaggctctgaatca  c.15+420

         .         .         .         .         .         .  g.5865
gcccttggccagaagaagcacctcctctaggaaatcattccttctttttagtaatacgca  c.15+480

         .         .         .         .         .         .  g.5925
attgaaaagtatgtgtgggttatgtgctgttaggtgctaagcattttagctatgaattaa  c.15+540

         .         .         .         .         .         .  g.5985
ctcataatcctcaaaataaatctggggtatagagagaggttcttgtttcaattagaaaag  c.15+600

         .         .         .         .         .         .  g.6045
taatgcttggagagactatgatttgcccaaggtcactgccaatagatgacttgattagaa  c.15+660

         .         .         .         .         .         .  g.6105
gcagggtatgtttgaatgcgaagtccaggctcaaaaaggggccttagtggctcctactag  c.15+720

         .         .         .         .         .         .  g.6165
actggtatcttaaggcaaggaaaacagaatatgtccctaatatctaaaaccatgcctagt  c.15+780

         .         .         .         .         .         .  g.6225
gcccaggccaggcttgaatcaatgctcaacgcatgcatgtgtaactgaacagaactgccc  c.15+840

         .         .         .         .         .         .  g.6285
agaaccttggctcaggccaagtaggccagaccaccccacaacagacatcttccctgaatg  c.15+900

         .         .         .         .         .         .  g.6345
cagggtttgagaagtgccctaatgccctctaactgatgctgagtttgaagaatccatcag  c.15+960

         .         .         .         .         .         .  g.6405
ttaaggggaggtgtttctgagtttgaagaatcaaacaccttcctaattggtaggaatcct  c.15+1020

         .         .         .         .         .         .  g.6465
gaaaacactccacaccggagtaaaagactttggttttttatctttatgcctgactaaaag  c.15+1080

         .         .         .         .         .         .  g.6525
ttaactctcattctttcattcagcaaatattttgtgctagtgcatgacactgcagattaa  c.15+1140

         .         .         .         .         .         .  g.6585
tatcgtagatgaactgagtctgggctaggtagagtcaaaaaaaaatttcctaaaggagcc  c.15+1200

         .         .         .         .         .         .  g.6645
tgtacctaaactgagtcttcagagagaagttggaactggcaaagtgaggaaggacggggt  c.15+1260

         .         .         .         .         .         .  g.6705
ctggagggaagagtgagtgcaaaggcacagcacatacagaatgcctgcatgctctagaat  c.15+1320

         .         .         .         .         .         .  g.6765
ccaaaactgtgtcagccaaatttgagttgatggagggacagccaaactgagatacccagg  c.15+1380

         .         .         .         .         .         .  g.6825
cggtggttggatttatggatctggatttcaggggagtgggcagggctaggggaatagaac  c.15+1440

         .         .         .         .         .         .  g.6885
tgagggtcatgatgtcagtggtaggagttgaagtcttggaagaaagagtagatagaaact  c.15+1500

         .         .         .         .         .         .  g.6945
ttgttttctgatgaacattctatgaggaagttcagcagaggttggaaacatctttaccat  c.15+1560

         .         .         .         .         .         .  g.7005
ttataaataaattttatgtaaaatcctatcctgctgtcatgtttaagcaacttattatgc  c.15+1620

         .         .         .         .         .         .  g.7065
acagcaccaggacatcaatgtaaattgcatgccagtctttgctctcagtttcaaaggcat  c.15+1680

         .         .         .         .         .         .  g.7125
tcttccctgcctgctgtctaatctttacaaagaaaggttaactccagaggtcaggaatct  c.15+1740

         .         .         .         .         .         .  g.7185
gaacacagaaaaccagattgcatcatattcattctaatcaataaacattatataattttt  c.15+1800

         .         .         .         .         .         .  g.7245
aaaactgtttctcatcttttatttcttcattttaatgaatatgtcaacacaaagccgtaa  c.15+1860

         .         .         .         .         .         .  g.7305
atgaaatcacatttacacaaaagtacaactggggtaagaaaattcaaaagataaagtaat  c.15+1920

         .         .         .         .         .         .  g.7365
aaaattaaatttaaaatgaaataccctatgtatttgagtaagttgcttagcttctcccaa  c.15+1980

         .         .         .         .         .         .  g.7425
ccttggtttcctcatttctaaaacgaagaacttgcttaatattcaggctctgggccccac  c.15+2040

         .         .         .         .         .         .  g.7485
caccaaatccttgattcactggctctgggtctgtatgtaacaagcttctggagtgattct  c.15+2100

         .         .         .         .         .         .  g.7545
aatgattagccagagacaggacctactattctacgtaactgatttcctcttgctgctgta  c.15+2160

         .         .         .         .         .         .  g.7605
aaaaattaccacaaatttattggcttaaaacaacacaaatgtattatcttgaagttgtgg  c.15+2220

         .         .         .         .         .         .  g.7665
aggtcagaagtctgaaatcggtttcactgggctaaagtcgaggtgtcagtgtggctgttt  c.15+2280

         .         .         .         .         .         .  g.7725
cttctggagactctatgagagattgtgttttcctgccttttccatggattctgtttcctc  c.15+2340

         .         .         .         .         .         .  g.7785
ttctagaggctacccacattccttggtttgtagcctcttcctcgatcttcaaaaaaatgt  c.15+2400

         .         .         .         .         .         .  g.7845
atctctgcttttgtaatcacgtcacattttctcctcttataagtcaaatctccctttgcc  c.15+2460

         .         .         .         .         .         .  g.7905
tccctcttataatgacacttgtgattacatttaggatacacccaaataattaggatatct  c.15+2520

         .         .         .         .         .         .  g.7965
ccccatcccaagatccttaattatatatgcaaaagtctgtttggctagaaaagataatac  c.15+2580

         .         .         .         .         .         .  g.8025
tcacaggtttcaggggttaagccatacatatctttcagagtgagccattagccattattc  c.15+2640

         .         .         .         .         .         .  g.8085
agcctactgcgataatgtgcaagttccctttacaatctatgttctatgttcccatcaagg  c.15+2700

         .         .         .         .         .         .  g.8145
ttaattagaaatattagactctttttccacagaaaaaaaaaatgtagcagtagtttcatc  c.15+2760

         .         .         .         .         .         .  g.8205
tctaccctgacttctctctctttccttcatgcccagtaagaggaagtgaggtgcaccatc  c.15+2820

         .         .         .         .         .         .  g.8265
tgttcatctcatcaggtgttacctagaatcagagtcaggagaaagcacctcataaaacta  c.15+2880

         .         .         .         .         .         .  g.8325
ctctgacaagtaaaccatatcctggggaccaggtgagaattaaaaagctgtatactcata  c.15+2940

         .         .         .         .         .         .  g.8385
agctgccaaagagctgatggtactgaagtcacatggagctcaggaatttattcttgcatt  c.15+3000

         .         .         .         .         .         .  g.8445
tagaaagtatgcatataattctctcgaaaagaaatgaaatcatatttttctgtcggatca  c.15+3060

         .         .         .         .         .         g.8502
aattattcagaaatccgaactgtagaaaacatacaaacacacttgcttaatgttagc  c.15+3117

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.8558
    tttttaatcttatttttgtacacagtatacttttacataggcactgaaccagctgg  c.16-3061

.         .         .         .         .         .           g.8618
aaatgaatgcttggattttcgcagctgataaaagcagagttcagattctgtccttgagct  c.16-3001

.         .         .         .         .         .           g.8678
caatgtctggagaaagcagctgtgaatactgcttccttaattcagatgcctttggccgtg  c.16-2941

.         .         .         .         .         .           g.8738
aggggcatggcattttaaagctgcaataaactctgtactttttctctcaggggattagaa  c.16-2881

.         .         .         .         .         .           g.8798
aaaccaattgatttgatagtgactcagcagttttcaccttcctctttagccaatgccctg  c.16-2821

.         .         .         .         .         .           g.8858
cagctaagattgagaaacggattcagaactcacacctcttggtgcttggtggctcccttc  c.16-2761

.         .         .         .         .         .           g.8918
caaaccatcagctgttctttctactttctttcctattttttaaagcacagtctgaatcaa  c.16-2701

.         .         .         .         .         .           g.8978
gtgcttcagaaccatttatactaactcgtgttccaaacacataaccctgaaccctcttct  c.16-2641

.         .         .         .         .         .           g.9038
aaggccaccagttacaaagaatggggaaggttaatgagtaactccaccagtgcctgccag  c.16-2581

.         .         .         .         .         .           g.9098
aaagctcagctgtactccagccttccttcctctcttgcagagagaaacaatgcggcagtt  c.16-2521

.         .         .         .         .         .           g.9158
gaacaaagcgaaggcactgtaatgcccagtggcttcagtcacaggctggtctaaaattcc  c.16-2461

.         .         .         .         .         .           g.9218
atttcacagaattgaagataatttggggttattaccaattctcagcagctcaaattcaat  c.16-2401

.         .         .         .         .         .           g.9278
cccgttgatggtgagcatggggttcattttgagagtagaaaattggatgcagtggagaat  c.16-2341

.         .         .         .         .         .           g.9338
cagaatgttggatggtctctgccatttccccaaagatatcatcctaactgcatgctgctg  c.16-2281

.         .         .         .         .         .           g.9398
cttttaacaaatcagtatacaacttagtattttttgtgttgacaaattttcaaatataca  c.16-2221

.         .         .         .         .         .           g.9458
aaatattgagtctgaaggcaaaaagaataatttttcacttccattgcttcctaggtcata  c.16-2161

.         .         .         .         .         .           g.9518
acattcacatctgatatttcttccaaatacagactgttgttggcctgatcatcactcaca  c.16-2101

.         .         .         .         .         .           g.9578
catccaggcttgttacatctccacgccactgagtatcagggaacctgccccaatattcac  c.16-2041

.         .         .         .         .         .           g.9638
gtaggttcttttctattttccctaagcgtcggccaactttagaaataaagggacagagta  c.16-1981

.         .         .         .         .         .           g.9698
caaaagagagaaattttaaagccgggcatccgggggaggcatcacatttcggtaggttcc  c.16-1921

.         .         .         .         .         .           g.9758
gtgatgccccacaagccacaaaaaccagcaagtttgtattagggattttcaaatggggag  c.16-1861

.         .         .         .         .         .           g.9818
gcagtgtgcaaataggtgtgggtcacagacatcaagtactttacaaggtaatagaatatc  c.16-1801

.         .         .         .         .         .           g.9878
acaaggcaagtggaggcagggtgagatcacaggaccacaggaccgaggcgaaattaaaat  c.16-1741

.         .         .         .         .         .           g.9938
tgctaatgaagtttcgggcaccattgtcattgataacatcttatcaggagacagggtttt  c.16-1681

.         .         .         .         .         .           g.9998
taggatcaactggtctgaccaaaatttattaggcgggaatttcctcttcctaataagcct  c.16-1621

.         .         .         .         .         .           g.10058
gggagcgctgtgggagactggggtctatttcacccctgcagtctcgaccataagagacag  c.16-1561

.         .         .         .         .         .           g.10118
gcgcacctggaggggggctgtttataagcctatacctcctggctcgtattctctttctca  c.16-1501

.         .         .         .         .         .           g.10178
gggatgttccatgctgagaaaaagaattcagcgatatttctcccatttgcttttgaaaga  c.16-1441

.         .         .         .         .         .           g.10238
agagaaatatggctctgttctgcctggctcaccagcagtcagagtttaaggttatctctc  c.16-1381

.         .         .         .         .         .           g.10298
ttattccctgaacaattgctgttatcctgttcttttttcaaggtgtccacatttcatgtt  c.16-1321

.         .         .         .         .         .           g.10358
gctcaaacacacatgctgtacaatttgtgcagttaatgcaattattacagggtcctgagg  c.16-1261

.         .         .         .         .         .           g.10418
caatatacatcctcctcagctgacaggattaagagattaaagtaaagacaggcataaatc  c.16-1201

.         .         .         .         .         .           g.10478
acaaggatattgactggggaagtgataagtgtccatgaaatctttacaatttatgtttag  c.16-1141

.         .         .         .         .         .           g.10538
agattgcagtaaagacaggcataagaaattacaaaagtattaatttggggaactaataaa  c.16-1081

.         .         .         .         .         .           g.10598
tgtccatgaaatcttcacaatccacgaacttctgccatggcttcagctgatccctccgtt  c.16-1021

.         .         .         .         .         .           g.10658
tggagtcccagacttcccgcaacaactgagaactctggagggcctacccttcacccactt  c.16-961

.         .         .         .         .         .           g.10718
ccacccttcttatatctcttaaggagctgtgttcagatggttacatttcgcttgctgagc  c.16-901

.         .         .         .         .         .           g.10778
aagactgcattttcattatcctgggctaaaatcaattggtatttaagttagagcaaaaag  c.16-841

.         .         .         .         .         .           g.10838
ggttctaaccctatttacagcagcacacatacacttacattagaattggctttaagggaa  c.16-781

.         .         .         .         .         .           g.10898
aaattcaatcaatcgacaaatttccactgattaccttctatgagccaagactgccatagt  c.16-721

.         .         .         .         .         .           g.10958
ctcagccttcatgcagcttataggctagcaaaaaagccagacagtgcacaagaactcaca  c.16-661

.         .         .         .         .         .           g.11018
agtgtgttgagtgttgcaagagtaagtttcaggggctctccatgacttacctggttgaga  c.16-601

.         .         .         .         .         .           g.11078
aaccctttaactttttttttcctctgggtgtaaagtgaagagatggcaatcagagtaggt  c.16-541

.         .         .         .         .         .           g.11138
tccattgtgtcattgtgaaaagatgctgggctggcgtgtctcctgaaggccacccatatc  c.16-481

.         .         .         .         .         .           g.11198
tttaaactttattttcatgcattcgcacaaatatagatgtgttccatagatgaggcagat  c.16-421

.         .         .         .         .         .           g.11258
agcagaggcttctgcctacagcaaggctagtttggagagggttttgctgtcagggttgga  c.16-361

.         .         .         .         .         .           g.11318
cccacacacctcttcatagatgctttttcttttttttcccagagtttgaaagggaaatgg  c.16-301

.         .         .         .         .         .           g.11378
agtctcaagttcagggaggttacagtgtagacccacaaatcagctaagtacagctaaggg  c.16-241

.         .         .         .         .         .           g.11438
tggagaagtctatgcaatatccagcactcttctgattaattagaagtctttaaaattcac  c.16-181

.         .         .         .         .         .           g.11498
agaaaccatattgtcttccctaaatgattcatatgtcaagacacagtaaagatattatat  c.16-121

.         .         .         .         .         .           g.11558
gtggaacatcatacacaaacataggtccatatagaaattcttaccttagtaaactgccaa  c.16-61

.         .         .         .         .         .           g.11618
ttttctgaaatgctctttaaatcctgctaatggtggcatttgtgtctttgtcacctacag  c.16-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center