homogentisate 1,2-dioxygenase (HGD) - 802 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.11750
gtatgagcaaataaagtgcttagaagagctctgaatcctattcctggatgactagctttc  c.87+60

         .         .         .         .         .         .  g.11810
aggccaaagtgcctccacccaccgtggctcttccaatctagcctgtgaactgtctagagg  c.87+120

         .         .         .         .         .         .  g.11870
tttcccaagtcataggggcaatgaagatacagagcaatgacaacacaaagattaaaattg  c.87+180

         .         .         .         .         .         .  g.11930
gattggtggcacagcagccaatccaaactagtgaaattaactgtagggtttccagtagga  c.87+240

         .         .         .         .         .         .  g.11990
tccccaaaaatccagagttaaagagaatccctcatattccccttgaacaccatggatgtg  c.87+300

         .         .         .         .         .         .  g.12050
agcattatgataaaataacaaggtgctttcacatgtatgcacaaagatgttcatactagt  c.87+360

         .         .         .         .   g.12091
gctggttagaaaagcaacaacacgggaaacaaaaatatttt  c.87+401

--------------------- middle of intron ---------------------
         g.12092    .         .         .         .           g.12132
         c.88-401  caaaactttttgcaggccgtatcatagcataaaaaaatcct  c.88-361

.         .         .         .         .         .           g.12192
catttcttaaaaaaaaaaaggaaaaaatgcctgattattacagggttacaggtatgatag  c.88-301

.         .         .         .         .         .           g.12252
ggtcacaattttggaggataagaatgcaaggaaaaataccaacatgtgaacgcttggtta  c.88-241

.         .         .         .         .         .           g.12312
tttctggttgtgagataatgggtgttatcatatagtttatacattttctacaataaatat  c.88-181

.         .         .         .         .         .           g.12372
atattacttttataatcggggggcaagtcacatcaaaagttgttacaagaaacatatcgg  c.88-121

.         .         .         .         .         .           g.12432
gttgcagatggtcatgtgcagtcgcccagagcatccccatccccctactgagttggttgg  c.88-61

.         .         .         .         .         .           g.12492
tgggaaggtgggatgcttttcggatgggagtaatattgtttattgcatcctttgtttcag  c.88-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center