homogentisate 1,2-dioxygenase (HGD) - 4368 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.12641
gtacaaggattagatgaattctgacctgcagactgtgggtactatgacagggactttgtg  c.176+60

         .         .         .         .         .         .  g.12701
ctgcctccttcccctgggccacagcctcccagagctgcccaagatcctgcttcttatagg  c.176+120

         .         .         .         .         .         .  g.12761
ctatggtctgggtcatggtcagaagagaatgaacttcctgccagctagcaccaagtgact  c.176+180

         .         .         .         .         .         .  g.12821
ggtggaagaaggtgaaggaaagctgcacagagctgggaaaatacacatgtccagttccat  c.176+240

         .         .         .         .         .         .  g.12881
ttacaaattacctcctatattcagaaggaaatattcctaatagtttggtcttcttctaaa  c.176+300

         .         .         .         .         .         .  g.12941
gactgtcctgttgagttttggcttggggtttacctgttttgttttgttttataatgacta  c.176+360

         .         .         .         .         .         .  g.13001
agtcacaattatggaagattcagagcaatatctttctcagctgactagaggtatgttctt  c.176+420

         .         .         .         .         .         .  g.13061
tgcaagaaaatgttgggtaaacgaagtttggatagttaaaaagtcacatattatggccca  c.176+480

         .         .         .         .         .         .  g.13121
ctgtggtttgaattaataaggtttttactctggtattcgcctttgctagaaaccagcata  c.176+540

         .         .         .         .         .         .  g.13181
ttcatttacatactgtgccatgttccatgtttgctctaatcctacatccaggtcaatgaa  c.176+600

         .         .         .         .         .         .  g.13241
cgtaatcccttgattaactcatatcaggcaggttggatgcagtatgtgttatagttttgg  c.176+660

         .         .         .         .         .         .  g.13301
gaggcagtaagtgttatgatttaaacaaatagtgtctaattataaaaattttaggctgag  c.176+720

         .         .         .         .         .         .  g.13361
gtatttgtgaagaggaatgctgctggtattagagactcggggagaagggcatgtggtctt  c.176+780

         .         .         .         .         .         .  g.13421
gtactgcttagtagggcagcctgggtttatctccacaggtccttctgagaagcaaatgag  c.176+840

         .         .         .         .         .         .  g.13481
atagtaagtaaaaaactataatggaccacacaaatgataaagattgcaaggtttaatcat  c.176+900

         .         .         .         .         .         .  g.13541
ggccaccctggaggcaggccccctaagtataaatcctggctccttttccagctgtgtggc  c.176+960

         .         .         .         .         .         .  g.13601
cttgggtaaatcatctgccctcttggatcctctagttcttcattcgtaaaacaaagataa  c.176+1020

         .         .         .         .         .         .  g.13661
ttatggtacctatttcatagctgtggtgaggattaaaagaaaggatgtgtgtaaagcaca  c.176+1080

         .         .         .         .         .         .  g.13721
ttagcttagcttagcacattggcacaggcacatggttagtgctcagttaatgctagttat  c.176+1140

         .         .         .         .         .         .  g.13781
tgtcatgataactatcattaagtattgccatcatagcagagtttctgcctcatttccagg  c.176+1200

         .         .         .         .         .         .  g.13841
gtatctctaggaggctgtcaagagaactgggcatgatatgtggcaagtgctatgttacaa  c.176+1260

         .         .         .         .         .         .  g.13901
tgtcagtatcaacagtacttttctctcaatagatatatgcgtgggaagaggaagagatag  c.176+1320

         .         .         .         .         .         .  g.13961
agaaagatttctatacatgtcaaaaatcaggggataattccttcactatttaatcatctc  c.176+1380

         .         .         .         .         .         .  g.14021
tctctctctctctgtaagcccaaatagggtaagataagcacgcagataattctgtccatt  c.176+1440

         .         .         .         .         .         .  g.14081
ctaatttatgacaacctgtcctctatgactatgttcttgactttatggcccattccctaa  c.176+1500

         .         .         .         .         .         .  g.14141
caggccacctggtctccggattctgcagcctgtccccattattcagcaatatcttcagcc  c.176+1560

         .         .         .         .         .         .  g.14201
agcaggagctgagctttgttccagcaggctgaaaaggagctgttggcatttcattaagaa  c.176+1620

         .         .         .         .         .         .  g.14261
gctggcactgttccctgaatcagaattaaatctctgttcagggcaatgtagtactgcctg  c.176+1680

         .         .         .         .         .         .  g.14321
gggagttttataaactcagctaaaaaataagggacactaggtatggctcacccatctatt  c.176+1740

         .         .         .         .         .         .  g.14381
tagaagaactctccaaagatatccacaagaattttgtggaaatgcttcccacccaaaatc  c.176+1800

         .         .         .         .         .         .  g.14441
tccagtgggaaaatgggaccagtcttatccataagtaggccagcctgaaattcttagtta  c.176+1860

         .         .         .         .         .         .  g.14501
ctactcatctgaaccatagcatacagggccaccacaaaactattaaagagtctatctacc  c.176+1920

         .         .         .         .         .         .  g.14561
tacctacgtacctacctacctacctatcagggattaatttttatcagattagctagctga  c.176+1980

         .         .         .         .         .         .  g.14621
ttgatcccttgggtcttgaaaaggcaaaagtctggagagataatttggaaaatgtggact  c.176+2040

         .         .         .         .         .         .  g.14681
gtgataaaaattcagaagattaagagaagaaaggcaatttaacaaacacatgataagcca  c.176+2100

         .         .         .         .         .         .  g.14741
gcagctactgtatgccaggcatttttggtacacaaactctctgagttctcacaacaatct  c.176+2160

         .         .      g.14765
taggtgacaaggatgaagaacata  c.176+2184

--------------------- middle of intron ---------------------
                        g.14766         .         .           g.14789
                        c.177-2184  aggttcaggaagtctagtaactct  c.177-2161

.         .         .         .         .         .           g.14849
cccaggatcacacaggtggttccaagacatacacacatgctctgaacttcatatactggg  c.177-2101

.         .         .         .         .         .           g.14909
agctggagaggcttagtaagaccaaggtctgaggtcacgtcatcaagagatggagaaatc  c.177-2041

.         .         .         .         .         .           g.14969
aaatggaaactaaacagatctagccctttttcccccagatggctcaatgttgggccaggc  c.177-1981

.         .         .         .         .         .           g.15029
caactcaactcactgaggtagactgtccttggtcttgaaagggccagagcctgttgattc  c.177-1921

.         .         .         .         .         .           g.15089
aggtctggtcttccgttgtccttctgtattttgtcagggcagtaccctctgaaaggactt  c.177-1861

.         .         .         .         .         .           g.15149
gggtccctcttagtgagcttcaatgtcccttccagcttctggaaggtcttatcctggtgt  c.177-1801

.         .         .         .         .         .           g.15209
cctttcagattcctttatcagagtcttcttcccttcctgaagcctgagatctggtcctgg  c.177-1741

.         .         .         .         .         .           g.15269
tagagaggacacactttaaaaagaaaagaaagaaagacaaataaaggcataaatgtacta  c.177-1681

.         .         .         .         .         .           g.15329
caataaaacatggacatacactcttataattttagagtacagaagtgttaatttattttt  c.177-1621

.         .         .         .         .         .           g.15389
attttattttaagttccagggtataggtgcaggatgcacaggtttgttacataggtaaat  c.177-1561

.         .         .         .         .         .           g.15449
gtgtgccatggtggtttgctgcacttatcaacctatcacctaagtattaagcccagcata  c.177-1501

.         .         .         .         .         .           g.15509
cattagccatttttttaatgctctccctcccccaactcccaccccccaacaggccccagt  c.177-1441

.         .         .         .         .         .           g.15569
gtgtgttattcccctcactgtgtccatgtgttctcattgttcagctcccacttatgagtg  c.177-1381

.         .         .         .         .         .           g.15629
agaacatgcagtgtttggttttctgttcctgctttagttcgctgagaatattggcttcca  c.177-1321

.         .         .         .         .         .           g.15689
gttccatccatgtccctgcaaaggtcatgatctcattcctttttatggctgcatagtatt  c.177-1261

.         .         .         .         .         .           g.15749
ccatggtgtatatgtaccacattttctttatccagtctatcattgatgggcatttgggtt  c.177-1201

.         .         .         .         .         .           g.15809
gattctatgtctttgcattgtgaatagtgctgcaataaacatacgtgtgcatgtatcttc  c.177-1141

.         .         .         .         .         .           g.15869
ataacagattgatttatattcctttgggtatacacccagtaatgggattgctgggtcaaa  c.177-1081

.         .         .         .         .         .           g.15929
tggtatttctcattgtaggtctttgaggaatcaccacactgccttccacaatggttgaac  c.177-1021

.         .         .         .         .         .           g.15989
taatttacattcccaccaacagtgtaaaagcattcttatctctccacagcctttccagaa  c.177-961

.         .         .         .         .         .           g.16049
tctttttctcttataaattaatatcaaaaagacaaacccaatagaaaatgataaaggact  c.177-901

.         .         .         .         .         .           g.16109
tctacaagtaattcacagaaaaactataaagagccaataaacaaatagacttgttttttg  c.177-841

.         .         .         .         .         .           g.16169
gaaatattttgtattttctaattcataataaaggaaatacaaaataaaatgagatactat  c.177-781

.         .         .         .         .         .           g.16229
ttttcacctaaaacactaaaatttttaataatactccagatttgtgaagatgtgggtgac  c.177-721

.         .         .         .         .         .           g.16289
caggcactctcacacgttgttagtatgataataaagagttaaaatgatctgataattttg  c.177-661

.         .         .         .         .         .           g.16349
tttagaaatgcactggacgtatctgaaagaatatataagaaatatataagaaaatcacta  c.177-601

.         .         .         .         .         .           g.16409
agctctgatgcctctgaggaatagccctgaagaaactggaggacgaaggtgccatttacc  c.177-541

.         .         .         .         .         .           g.16469
tttcaggactttttaattacttgaattatttttacctttggcatgtattacttttgtaat  c.177-481

.         .         .         .         .         .           g.16529
tttaaaggagaaaattgatttactatttcaaaaataacaaagataccacccatattctct  c.177-421

.         .         .         .         .         .           g.16589
caagctgcgtagaactcattgttcttgccttccagagcaaggactagcatcctatgatac  c.177-361

.         .         .         .         .         .           g.16649
acacataagctaatgtttttctatggattttcctacacagatatccctcaaggtacttcc  c.177-301

.         .         .         .         .         .           g.16709
ccttcccttatagtttttagaaaagacaattcttcattttttggcagcatggaaataacc  c.177-241

.         .         .         .         .         .           g.16769
atgagtcagagtccatttgaagcatgatgggtggaatgaaaaagtgagaagaggccaggg  c.177-181

.         .         .         .         .         .           g.16829
ctgtgggcagcagatggccatgaaaagtgatgctgtatcattgcttcactgcttcacaca  c.177-121

.         .         .         .         .         .           g.16889
ttagagcctacaggtcgttgttgacttgagtgtcttcctgatggtactgcctgagccatt  c.177-61

.         .         .         .         .         .           g.16949
ctgtgtatcactcagaacattactctaaggcttgtatatcttgtatgtttttccctctag  c.177-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center