homogentisate 1,2-dioxygenase (HGD) - 1726 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.34950
gtaagtcagtcccatccacaccctccctactgctctcctctcttctgtggtgagtgagcc  c.342+60

         .         .         .         .         .         .  g.35010
aaccatttgcagcctgaatgccaagcagaagcagccctatcaggaggcagcagagacaaa  c.342+120

         .         .         .         .         .         .  g.35070
accacctgcgtatgctttgggggctggcggagggatgtcttacttacagaaaccatatgg  c.342+180

         .         .         .         .         .         .  g.35130
cccctgacaccagagggtattcatgaactatttatatctcagaaaggccaatgacaattg  c.342+240

         .         .         .         .         .         .  g.35190
aacattttcttacttaagttcctttcttttggctagaacgggggcttttaacctttttct  c.342+300

         .         .         .         .         .         .  g.35250
cactttgatgtctgatgtctgatgatgtctttgtttataaatatataaaataaattatat  c.342+360

         .         .         .         .         .         .  g.35310
aaaattacaaagaagctaatgatattgaaatataacgataaaaatactattaaaaacaaa  c.342+420

         .         .         .         .         .         .  g.35370
tttgatttggtttatagtcattcatgtgctttcttgttaatgtgctaaatcataatatct  c.342+480

         .         .         .         .         .         .  g.35430
atggaaaacatctaataattctggtatgagcataaatatactttgaggtatctataacaa  c.342+540

         .         .         .         .         .         .  g.35490
ctataatgtgatatccatgatttttatcattgataaagttacaggcacctctaatactgc  c.342+600

         .         .         .         .         .         .  g.35550
tgtggttttttgcctacattcatattagttgaaagaaatgataaatttcactcagagatt  c.342+660

         .         .         .         .         .         .  g.35610
agcaaaagtaaatataaaatatttcccatccaagttcataaatctccctgaagtagatgc  c.342+720

         .         .         .         .         .         .  g.35670
ttgggctagaatggcgtcaattcaacatggcaactctagttagtacaatgctgattggaa  c.342+780

         .         .         .         .         .         .  g.35730
gctctgtttggtagttataggtcccaggagtactggaataactgcacagagcaaggagta  c.342+840

         .         .     g.35753
tctgggggagaggagaaaggagc  c.342+863

--------------------- middle of intron ---------------------
                          g.35754       .         .           g.35776
                          c.343-863  tctaaggaagtggggctcaaaga  c.343-841

.         .         .         .         .         .           g.35836
gaccagtggagggttctgcagaccagcctcagctcatggcttacgtagggacactccaag  c.343-781

.         .         .         .         .         .           g.35896
tgccgagccataggataaattgttggaaacatcttgaagttctcatctttattaagtgct  c.343-721

.         .         .         .         .         .           g.35956
ccaaactctttgtagactcacttaaatataccctaaacttacaaattgagttaaaataca  c.343-661

.         .         .         .         .         .           g.36016
aaatgatatccccatctcctttcttgtgtgaattgtagatatctggaggcgcagagctct  c.343-601

.         .         .         .         .         .           g.36076
ctccttttggctctccatctgcaggtttggggctgagggctattttgagaagacccatgt  c.343-541

.         .         .         .         .         .           g.36136
gttaaggtttcttgcactatggatcatctggtcacacagcagagagaattacagtccatc  c.343-481

.         .         .         .         .         .           g.36196
tgaatacagtcctctgccctgttccagagagattaggctgaccctatccataagcagagg  c.343-421

.         .         .         .         .         .           g.36256
gctgcccatagtggagtgtacttgagaggcattaactggtccctgatgctgcaaccttcc  c.343-361

.         .         .         .         .         .           g.36316
tccccaagcctcctagatgcctgatggtacctccaacagaatctcttcttccagttgatg  c.343-301

.         .         .         .         .         .           g.36376
tcaagcatcaaattgataaaataccaagtaatgaactgatactctgtaagttcttctgat  c.343-241

.         .         .         .         .         .           g.36436
atagccactaagacaacccagatttaggccatggctggagactagggtaaaccacaaact  c.343-181

.         .         .         .         .         .           g.36496
accaaacatgagtcagtaaattcaggctccttagaggctgcctggattccaaacgtccca  c.343-121

.         .         .         .         .         .           g.36556
ccggtcccaaagggaagaccctagtagaaatgtgcctcatgaccctcagggaccagtgga  c.343-61

.         .         .         .         .         .           g.36616
agggctgcctcttgggcaccgttcacattaacctttccctcttctgtgggtctctcccag  c.343-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center