homogentisate 1,2-dioxygenase (HGD) - 2862 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.36768
gtaagtggctcagttctagggaaggacatgcccatcttctaagggattttggccagaagt  c.434+60

         .         .         .         .         .         .  g.36828
caaactccaggtttcactcttgtgaagtcacatatgcacatacatagttgtttttgttat  c.434+120

         .         .         .         .         .         .  g.36888
tggttttctcctcaaggcaatattcatatatatttattgacaatgataatgaatgagaca  c.434+180

         .         .         .         .         .         .  g.36948
aaaggcatttatcttgactgaacatcagtgatataaacaagcacatcacataacaatgta  c.434+240

         .         .         .         .         .         .  g.37008
aacagaaaagggaggatggagccctggaatgcaggagtagatcgaaaggcattttgactt  c.434+300

         .         .         .         .         .         .  g.37068
taagtctgagtccaaatatgcttttgttgttgtttgatatttcaaggatttttctgagcc  c.434+360

         .         .         .         .         .         .  g.37128
aaatatgagtgaccaatggcctgcgacacagccatcaggagatcctgagaacatgtgccc  c.434+420

         .         .         .         .         .         .  g.37188
aaggtgattgggctacagcttggttttatacattttagggaggcataagacatcagtcaa  c.434+480

         .         .         .         .         .         .  g.37248
cacatataaggtgtacattagatccaaactgtggtttttatctcagtagaaaagtaacag  c.434+540

         .         .         .         .         .         .  g.37308
cagatttaaagcaggcagaaaagaaaacagagaaatagagaacttagaaactctgtagtt  c.434+600

         .         .         .         .         .         .  g.37368
gcaggttgacctttgggctctgaatgatacaattttcccattggtttaaaatgtgcacaa  c.434+660

         .         .         .         .         .         .  g.37428
cagactgtaatatgtaaccagctggagtactagaaactctggcatacccttgaacttttc  c.434+720

         .         .         .         .         .         .  g.37488
cattttacacaaacacttgcaagtagaggcacctttctccttgtctttcctcattcttag  c.434+780

         .         .         .         .         .         .  g.37548
attatttgtttcccacgttttttttcttaaaaggaggaactgagctgtgacctaggggtt  c.434+840

         .         .         .         .         .         .  g.37608
ttgtgggtggtggattggtgtactgaatgtaggcaggactccacagtgtttcaccaccga  c.434+900

         .         .         .         .         .         .  g.37668
gtcgtttccaccctcttacctgtctcagtttctctctccagagatctagcacctctgaga  c.434+960

         .         .         .         .         .         .  g.37728
ggcctcaaaatgccaagtgatcagctcttatatgtatttccgggacaaaactatttttgg  c.434+1020

         .         .         .         .         .         .  g.37788
gggggttccctgtagcgccactgcacatcacaggggatgaatccctcagacactgcaact  c.434+1080

         .         .         .         .         .         .  g.37848
cagcccctagtcacccagggtgcctttcagttgggaagaacaaaatgccctttctcttca  c.434+1140

         .         .         .         .         .         .  g.37908
gagctgaggagctcagtctctcatttatgcacaaaaatgacagtcacacgaatgcgcagg  c.434+1200

         .         .         .         .         .         .  g.37968
caagccaactgagctaaatttggggagaaaaaacaatggagtagaccatttagaatacac  c.434+1260

         .         .         .         .         .         .  g.38028
ctccaaactggaaaccaaacagggtacccaaaagggagtcattcttgttgtctttagaaa  c.434+1320

         .         .         .         .         .         .  g.38088
aagacaacggaggccgggcacagtggatcacgcctgtaatcccagtactttgagaggccg  c.434+1380

         .         .         .         .         .   g.38139
aggtgggcggatcacgaggtcaggagctcgagaccagcctagccaacatag  c.434+1431

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.38190
         tgaaaccccatctctactaaaaaatacaaaaaattagccgggcgtggtggt  c.435-1381

.         .         .         .         .         .           g.38250
gggcgcctgtaatcccagctactcaggaggctgaaaaaggagaattgcttgaacccggga  c.435-1321

.         .         .         .         .         .           g.38310
ggcggaggttgcagtgaaccgagatcatgccattgcactccagcccggacaaccgtgtga  c.435-1261

.         .         .         .         .         .           g.38370
gactccatctcaaaaaaaaaaaaaaaaaaaaagaaaaagaagaaaaagacaatggagaaa  c.435-1201

.         .         .         .         .         .           g.38430
tcctttagaatggacctgtgaactagaattaggaacctaaacaagagcttcctaggaggg  c.435-1141

.         .         .         .         .         .           g.38490
aaaaatcaagaactgtcaaccaaacagggctcaggaggacttaacagttccatcagagga  c.435-1081

.         .         .         .         .         .           g.38550
gaagcccaaagttgaaggcgctttcaataggtccctgctgataccttagctctgagttca  c.435-1021

.         .         .         .         .         .           g.38610
ggcaactccttcagggttctgagtcttctctgaggcccaatgtgtccaggtgccaaatta  c.435-961

.         .         .         .         .         .           g.38670
ttgttgacaaaaatagtcaaactattaatatgtaaaatatttgaattgatgtattctgag  c.435-901

.         .         .         .         .         .           g.38730
ccaaatatgagtgaccagtgacccatgacccagccctcaggagatcctgagaacatgtgc  c.435-841

.         .         .         .         .         .           g.38790
ctttgaatatccttaatttctaaggttccccagggctgttcttgagtcccaggtcacagt  c.435-781

.         .         .         .         .         .           g.38850
gtgtgagtttccattaggaccacccattagtagcaggctacccgactttggcttcagcta  c.435-721

.         .         .         .         .         .           g.38910
acagctctgtgtaagcttaaaattcttaagtagaggagcttatatactggctttgcaaaa  c.435-661

.         .         .         .         .         .           g.38970
caaagtatgcaaatggcattcctgccttattatacactacctctggaactggaccatttg  c.435-601

.         .         .         .         .         .           g.39030
tgtccaaagcccaactctacatttcctggctgagcgaccttgtgagccatgaatcaggga  c.435-541

.         .         .         .         .         .           g.39090
caagatcacagccctatgacaaggctctggaggcctctctttgggtcaaatctcatatca  c.435-481

.         .         .         .         .         .           g.39150
ggccacctcccctctctccacttgagccgcattggccttcattcacttctttcaagctgc  c.435-421

.         .         .         .         .         .           g.39210
cgcgtgccctccttctaagcacttgcacttgctgttccttctgcctggaacattctttcc  c.435-361

.         .         .         .         .         .           g.39270
tttctccaaaccctcacctagataacaccttcagatatccggtcaaatgtgtcccttctt  c.435-301

.         .         .         .         .         .           g.39330
tgaagaagcctttgctgattcttcaaactaaccaagtcgctattctttcattccctcaaa  c.435-241

.         .         .         .         .         .           g.39390
cttgattttcacagggtcattacagtctgcaaagatattgttctgtaattatttgattgc  c.435-181

.         .         .         .         .         .           g.39450
tctctgactccccactagactctaagttccacaagggcagagcctgggtcattttgctcc  c.435-121

.         .         .         .         .         .           g.39510
ccattttatacccagctctgagcttgctacataggcactaaacaatgatttgtgttatga  c.435-61

.         .         .         .         .         .           g.39570
cgtaatttgtctagacaatgttaaaactgaaaatcacaagaattactctatatgtttcag  c.435-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center