homogentisate 1,2-dioxygenase (HGD) - 824 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.39665
gtgagttctgaagacttcagaccccctcactgttaattgacccctaaccgcaagctgctt  c.469+60

         .         .         .         .         .         .  g.39725
tctaattttatacacattattttccttcattctccaatctgtcttatttcatttagtgca  c.469+120

         .         .         .         .         .         .  g.39785
atccagagactgaggtctagaggccacaggtggtctggaaaagatttctagtgtacctca  c.469+180

         .         .         .         .         .         .  g.39845
aagcccctactctatttccttgtctctctgtctttgcccatctcttctggacctttctga  c.469+240

         .         .         .         .         .         .  g.39905
tgtgggagacctgggcagctgaaaagaaatgaagactaatactaatgggattaacttatt  c.469+300

         .         .         .         .         .         .  g.39965
acggtaactgtatttgccttgaaactctctcagtaaaagcccatttatcattagtaactg  c.469+360

         .         .         .         .         .    g.40017
caatttaaattcaaattttcatgagaccatctaaaatgtaaagtctatcaga  c.469+412

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.40069
        gattgttctggtctgcctattatacttgatggttttttagtatcaatatttt  c.470-361

.         .         .         .         .         .           g.40129
ggaatcaacattttcgtgtatatgtcacacaagcaaatgtcagcctttcactggaactat  c.470-301

.         .         .         .         .         .           g.40189
cagaaatgggtgattttccatcctatttctgctacccctttttgaccatgtcacaaaatt  c.470-241

.         .         .         .         .         .           g.40249
gtgcatatacaagttccttgcctggtgaccaaaaaagcagagtcattgttttattcacat  c.470-181

.         .         .         .         .         .           g.40309
tcttctagataggaaaatagctaatctaagttgtcagaatttatctttttccccaagaga  c.470-121

.         .         .         .         .         .           g.40369
ctcaataaagctctttgcatttggaatggaaaagcaaatgcagccttaagcctttcctgt  c.470-61

.         .         .         .         .         .           g.40429
tcatgaaatggttatcacaccaaaagaattgctcaccactgccctgtctttttttgtcag  c.470-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center