homogentisate 1,2-dioxygenase (HGD) - 606 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.40569
gttggtgatgtgtccccttctcttccctgcctctcactaatttgggagcagtcagatgtt  c.549+60

         .         .         .         .         .         .  g.40629
tcagctgctgctatttccaactctaaaatttctctgtcatgtctgggcaacgaggaggga  c.549+120

         .         .         .         .         .         .  g.40689
atctgagttatgcagaaggttccatgtgctgaagagtaagcaagcttgggtgcctgcttt  c.549+180

         .         .         .         .         .         .  g.40749
cttttaatatagcacataattctaaaggaaagaccacttgtcattgcactttcctaaata  c.549+240

         .         .         .         .         .         .  g.40809
tttacatatactctggataaggccctgttcccactaatggcagtagaggcagtgaaggtg  c.549+300

     g.40812
gac  c.549+303

--------------------- middle of intron ---------------------
                                              g.40813         g.40815
                                              c.550-303  ttt  c.550-301

.         .         .         .         .         .           g.40875
ttttttttttagtgtggctaaatcaggcttaccattatctctggacccaatgagagggta  c.550-241

.         .         .         .         .         .           g.40935
gactagaattggcttgggtcacatgtgtgattaggaattcagtttttctttttaaactga  c.550-181

.         .         .         .         .         .           g.40995
attttaaaaatttctttttaaaaaaattcagtttttcatgtttgctctggtcacctccca  c.550-121

.         .         .         .         .         .           g.41055
agcagctcaacaaacaagagctttacttttgcatgtgggatgggctatggctctgggcag  c.550-61

.         .         .         .         .         .           g.41115
cttctttataactacagctgtgatttcagagggcacaccagtgtctgctttccattccag  c.550-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center