homogentisate 1,2-dioxygenase (HGD) - 1823 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.41275
gtaaatcttcattacaagcctctaagcctcgcttgagatgtaggactcagataattgcat  c.649+60

         .         .         .         .         .         .  g.41335
gaaagttaaacatccttctcccttcgctgtctcactcaaacttccacttttctctctaga  c.649+120

         .         .         .         .         .         .  g.41395
caaattcttctctagaccaagtgtcttcccagaaaatatatgcaaaacagaaagcaaccc  c.649+180

         .         .         .         .         .         .  g.41455
aaaccaatccattataaatctctctagaatagtatacagacattggagataaagacggca  c.649+240

         .         .         .         .         .         .  g.41515
tgtaatagatttctggttgcatagtgtgtacaggaaagaatatagaagtttgggttactg  c.649+300

         .         .         .         .         .         .  g.41575
tgggcttgggtcaccagaaacagctccacagaagagatgagaatttgactaattctttat  c.649+360

         .         .         .         .         .         .  g.41635
gaaaagttgaggagagtaaagaggaaagggaacagctttgcaaaagcatataagtgagaa  c.649+420

         .         .         .         .         .         .  g.41695
taagctttgtgattaggaggaagatatttttgttaagtcagtgagatttataatggattg  c.649+480

         .         .         .         .         .         .  g.41755
gtttggattgctttttgttttgcatattgtataaaatgggaaggccataaaaatgccctg  c.649+540

         .         .         .         .         .         .  g.41815
ggctgtattcctatggaaaggagggatggactgggtgacacatagtctatgaacctctgt  c.649+600

         .         .         .         .         .         .  g.41875
gtacaccccaccaaatccacacacttagcagtcaaaaaaacacatcactcagtgctatga  c.649+660

         .         .         .         .         .         .  g.41935
gagatctagaaaccacaccccaggaggcagattaaaacattccaaagtgaaccaaggtct  c.649+720

         .         .         .         .         .         .  g.41995
ccacagcccccattcttctggcaagctggaggaagtgaaaatgttaggaggggttgttct  c.649+780

         .         .         .         .         .         .  g.42055
caaactgtctcttggattgaaagaaatggctgggaaaattggcccttggtttactctttg  c.649+840

         .         .         .         .         .         .  g.42115
gtcacatctcccaattcttcccttccttgtcaacagctttttagagcaaacagggacagg  c.649+900

         .    g.42127
ccagtgtgtgcc  c.649+912

--------------------- middle of intron ---------------------
                                      g.42128     .           g.42138
                                      c.650-911  ttctggtcagc  c.650-901

.         .         .         .         .         .           g.42198
tcctctgaggaatccaaatatgcagaggaaggtgggaggcagcaagaggcagctggagcc  c.650-841

.         .         .         .         .         .           g.42258
gtggtgggccgtctgtcatcctgttcacctcccactcttcccactctgctctggcttcct  c.650-781

.         .         .         .         .         .           g.42318
gctgctctatagtcagcatagcctccaggttccgtggaacatgtaccctctggaaaatat  c.650-721

.         .         .         .         .         .           g.42378
ctataatttgctaaccagccggggacttatttttttaagtccaggagctggaaatgataa  c.650-661

.         .         .         .         .         .           g.42438
aacactcctcagctcgctcctctcagagttaaactgtttttgcacttaagtttttcatgt  c.650-601

.         .         .         .         .         .           g.42498
ttggtcttttgatttatttcctttctctggaggaaacactcactcctaagcaaaggtaag  c.650-541

.         .         .         .         .         .           g.42558
caggcaggtcctaaatacttcttcctgagtggcagacagggtttttcaggctggagaacc  c.650-481

.         .         .         .         .         .           g.42618
gttttcagactggaatctgagttctgtctagggagcagaggcatgccttaggcaacagcg  c.650-421

.         .         .         .         .         .           g.42678
tgtaaccctttctatctgagatcaaggactgtcaatgacttctagaatattcaagggttc  c.650-361

.         .         .         .         .         .           g.42738
cttcaaaagaaaaagttctggagttctatcagatcttcccttttcctcttttcagttctc  c.650-301

.         .         .         .         .         .           g.42798
tttctctcttcccttcccctcacctgtagtgataagataatgcatataagattgttttgt  c.650-241

.         .         .         .         .         .           g.42858
taaccatagtcactccacaaccttagaaagtaatgctggtttttgtgaatttttttctga  c.650-181

.         .         .         .         .         .           g.42918
ccagattccttgggtcttcctaaaaggtaccagactggaaatgcagtgaatctttgagca  c.650-121

.         .         .         .         .         .           g.42978
atgaaagcaatttgtggagtagctcttgacatgaaagaaagcctttctcttcatgcaacc  c.650-61

.         .         .         .         .         .           g.43038
atgggcatctttcctatgttttggaagtttctaaaagacttttgggttactgttttctag  c.650-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center