homogentisate 1,2-dioxygenase (HGD) - 2625 nt intron 10 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.43223
gtaaagtaaaagggttggcaggcaagggaggaaatgaagagtgattgagcacttactgat  c.774+60

         .         .         .         .         .         .  g.43283
tgccaaggcgagtgttacaaactttacatatatcctttcgttgttatcataccactacgg  c.774+120

         .         .         .         .         .         .  g.43343
cactacaaataaagcaaatagttctagtagtcaattatactttcatagtcatggaaaagg  c.774+180

         .         .         .         .         .         .  g.43403
ccagtaatgataaataatttaccaatttcacagtaagtggcagaaccagaatttgaaccc  c.774+240

         .         .         .         .         .         .  g.43463
atatctgtctgactccaaaggttgtgccctttctactcaccaagcaatgaaaatattagc  c.774+300

         .         .         .         .         .         .  g.43523
aatatgtaggtttctataagtggtatggaaaacataatatatgggcagcataatatgttc  c.774+360

         .         .         .         .         .         .  g.43583
tgaaaagtaaatgagttaacagatcagccaagatttatagtctccaataccaccctattt  c.774+420

         .         .         .         .         .         .  g.43643
caaatacaagcaattctacaaaacaagtagaattcagttaattagcttggcttggtttgt  c.774+480

         .         .         .         .         .         .  g.43703
accaccaggctggcaattcaggacacaagcaaaggcacagatattaataaataataataa  c.774+540

         .         .         .         .         .         .  g.43763
caacaatgtaatatggactctataacataatatattactaaatgtactgaatatatatta  c.774+600

         .         .         .         .         .         .  g.43823
gaataaaataatcatataataagaagaacccaaagatctcttctgtttagcattatttgt  c.774+660

         .         .         .         .         .         .  g.43883
ttgcttcattttgtctatttgacttattccttatattttccaaggtatgttattcttctt  c.774+720

         .         .         .         .         .         .  g.43943
aggcagcatctagagataatgccaaccagccgaggccaaccagtttggcacttaaaatta  c.774+780

         .         .         .         .         .         .  g.44003
acccctgaagcagacatattgttattctcttattctctgggtcaaggtctctcaaaattc  c.774+840

         .         .         .         .         .         .  g.44063
gggggctatttgcatcagaaatcctcaaggaggcttgtttaaaattcagatcctaggctg  c.774+900

         .         .         .         .         .         .  g.44123
ggcatggtggctcatgcctgtaatcccagcagtttgggaggccaaggcaggcggatcacc  c.774+960

         .         .         .         .         .         .  g.44183
tgaggtcaggaattcaacaccagcctggccaacatggcaaaaccccgtctctacccaaaa  c.774+1020

         .         .         .         .         .         .  g.44243
tacaaaaattagccagatgtggtggtgcacacctgtaatcctagctacttgggaggctga  c.774+1080

         .         .         .         .         .         .  g.44303
ggcaggagaatcgcttgaacccaggaggtggaggttgcagcgagccaagatcatgccatt  c.774+1140

         .         .         .         .         .         .  g.44363
gcactccagcccgggcgacagagcaagactccctctcaaaaaaaatgcagatccttagat  c.774+1200

         .         .         .         .         .         .  g.44423
actactctagccttgcaaaaaatgataagctttggagatgggacatggaaacctacattc  c.774+1260

         .         .         .         .         .     g.44476
attttaagcatgttccccagatcattgtttacatacaattgttaaagaaccac  c.774+1313

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.44528
        aattgtagaagcagccagtagctcctccgaaaggtttgcactttccaagtgg  c.775-1261

.         .         .         .         .         .           g.44588
accctgtgctggttattttctgtgtgagtccccactgatccattctccctctttgccatg  c.775-1201

.         .         .         .         .         .           g.44648
atctgtgccctggaaggttgactgtatcacccgggctccctagccagctggtttctgttg  c.775-1141

.         .         .         .         .         .           g.44708
ggttcaacccacaggaaactacaaggcaggaggaaagacaaattgggatatttcttcccc  c.775-1081

.         .         .         .         .         .           g.44768
tgcttcctcgctgtttaggactgtgtttctgacagtagctgcatcccccatatgacctca  c.775-1021

.         .         .         .         .         .           g.44828
gttcctgttgggtagccctagtggtgggctggagctgattcatagtgacttgcaaaagct  c.775-961

.         .         .         .         .         .           g.44888
gatatgcacgcttctgtccaactgtgtatttgttgatgtcatactggtagctagaaaatc  c.775-901

.         .         .         .         .         .           g.44948
atcatggtgagactgtatacaccttagaaatcagtaaacactatatgtcaatgctttatg  c.775-841

.         .         .         .         .         .           g.45008
tatttttttcagagtgctagttgtgaaatatttaccagcacaccactgggtaacaccctt  c.775-781

.         .         .         .         .         .           g.45068
ctttataattctagctcttgctaaagtcctataacaatatttccctcctcattccacatg  c.775-721

.         .         .         .         .         .           g.45128
cccaggaatagcagtgtcttcccgctattgctaggctcagatacctcaacatttctagtc  c.775-661

.         .         .         .         .         .           g.45188
attccagttaaccctaaccacgcctctatgagtagcgccttcattaaaatctttagcact  c.775-601

.         .         .         .         .         .           g.45248
ttcggacccatagatacagaagggaccaccttcctatagcaggacactgatcctcttcta  c.775-541

.         .         .         .         .         .           g.45308
ccccaggacaggaccaggaagtattatgttaggattgctctgaaatctcaagtccttgga  c.775-481

.         .         .         .         .         .           g.45368
gttggaacttttagaggccttctcccctctcctggactcaccaacccaggcactgtgtct  c.775-421

.         .         .         .         .         .           g.45428
attgcaagctcctctaggctgaaattacctggagaagcatcacagcaggtactctctgtt  c.775-361

.         .         .         .         .         .           g.45488
ccaggaaacagaaggtagcccagattgtttgagaactgctgacatccacagatcctcaca  c.775-301

.         .         .         .         .         .           g.45548
gttaggttaaaaattgttgaaaaggcactacttggagaatgtgctgtgtttctgctgcat  c.775-241

.         .         .         .         .         .           g.45608
gtgtgatcagaaggcagctgcagcttatgaaccagaaaaatagggttagtggctaagtag  c.775-181

.         .         .         .         .         .           g.45668
agggtgtgtggagcaaccacaaaatgattcagggttatacttctcccaaaggacggtaaa  c.775-121

.         .         .         .         .         .           g.45728
attaaatcgagaacaaaatcaaatcaaaagaagagagaggtatactcagtacatattgtg  c.775-61

.         .         .         .         .         .           g.45788
ggatcacagctacaaaagcattagatggtaaaattatcctttcctgctttttgtgtttag  c.775-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center