homogentisate 1,2-dioxygenase (HGD) - 3007 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.45953
gtaagtctgaaccctgtaggggccttgggatgaggcaacgcttgggtgggaggggtccac  c.879+60

         .         .         .         .         .         .  g.46013
agtagacccctgacatttacagatctaacatttccaatgtcaccattggaagccctagat  c.879+120

         .         .         .         .         .         .  g.46073
atagtcatttgtcctttggtgagggagtaaataacacaactagtagggaagcaaagccag  c.879+180

         .         .         .         .         .         .  g.46133
atactcaacattcccctgtgaacatagcttcattctctacagagcattggtgatactctg  c.879+240

         .         .         .         .         .         .  g.46193
acttgtatttgccaaactaagtggataaacacttagtttctttgtggaaaatttatcccc  c.879+300

         .         .         .         .         .         .  g.46253
caaaacaaccaagtgttaatgtcggtggtagaatgaggagaaaggaactttatgaatttg  c.879+360

         .         .         .         .         .         .  g.46313
gagaagtccctgaccccacaactctcaagagcctcctctatgatctctgacttctcaccc  c.879+420

         .         .         .         .         .         .  g.46373
cagtgccttcattcctggctgtatttggcagtgacagagtgaacagcccacttctaaagt  c.879+480

         .         .         .         .         .         .  g.46433
tactcataactttcagtgcttgagtttaaaccaaagaaattctagagcatgaacttggtc  c.879+540

         .         .         .         .         .         .  g.46493
atatttttcactcagttcgcaggccacaaatggtctctggtctacagtgcaggctcccaa  c.879+600

         .         .         .         .         .         .  g.46553
gaccctacattcttaataaagtggtggttctgagaccccggggggaagttcattttgcag  c.879+660

         .         .         .         .         .         .  g.46613
ctcacttcataagagatgaacctaacccacaagctggaaggataattagagcagaagtca  c.879+720

         .         .         .         .         .         .  g.46673
gagactcagaggcaaaaggattattgtgagccagttcagtttatctctggggggacaaac  c.879+780

         .         .         .         .         .         .  g.46733
ctacctctccaaacagcagcaactcttaataaaagcaaaggggaaaagaaaagtgagaca  c.879+840

         .         .         .         .         .         .  g.46793
tcagaccccaaacaaacagcacgaaaaaggatcctgagacactgataaagctttatttgt  c.879+900

         .         .         .         .         .         .  g.46853
gattcactacctttgctttaatagtttcagatcatgtcccatgacagttgaagaaatgtc  c.879+960

         .         .         .         .         .         .  g.46913
aattctcacagcaataagggttgggtttatttttatttgaatttacacagatgcgatctt  c.879+1020

         .         .         .         .         .         .  g.46973
ctctgtattgctgcaatagttatttttccaaaattcagttctgatcatgccaccactgtc  c.879+1080

         .         .         .         .         .         .  g.47033
ttcattagaaagcctttgcaggcttcccatggcttaggattaagtctgcactctgaagca  c.879+1140

         .         .         .         .         .         .  g.47093
tggtgtttgatgctcttcaccatctgtccctggactcattttccagtatcacctcttgcc  c.879+1200

         .         .         .         .         .         .  g.47153
cctctcccttctgtcaatgcactggggttttagccttctctcctcttaacaaaatctctg  c.879+1260

         .         .         .         .         .         .  g.47213
tgcactttgatgtgttttcagtgattaaaatgtcatttcccttccttcccacttccttag  c.879+1320

         .         .         .         .         .         .  g.47273
tcctccctccctccctccctccctttttcccccatccccgccacgtccttcctttctttt  c.879+1380

         .         .         .         .         .         .  g.47333
tttttttttaacttttattttaggttcaagggtacatatgctccttccttccttccttct  c.879+1440

         .         .         .         .         .         .  g.47393
ttccttccttccttcctttctctctctctttttctttctttctgttcattcttgaagacc  c.879+1500

      g.47397
tacc  c.879+1504

--------------------- middle of intron ---------------------
                                             g.47398          g.47400
                                             c.880-1503  tca  c.880-1501

.         .         .         .         .         .           g.47460
aatgtcacctcctctttgaagccttccttgaccctttcaggtagaattagctgcccaacc  c.880-1441

.         .         .         .         .         .           g.47520
cccaccccacaattaatgctaaagaagcagggaatcgatccccatgatctttgaatctcc  c.880-1381

.         .         .         .         .         .           g.47580
agactcttacatggcatctgaaagggaacatgattgttgatttcaattaaattgaatctc  c.880-1321

.         .         .         .         .         .           g.47640
aaccttctcactaaagaattctgaagagttttaaaaagtataatttcgtccctcaaccta  c.880-1261

.         .         .         .         .         .           g.47700
tcctatctctacactaccactatgaagactacggatgtaaatgctgtgttttagacctga  c.880-1201

.         .         .         .         .         .           g.47760
aagtcaaacaaaggtaggaaagcaatgaaccacttctcagacttttctgccaatggatac  c.880-1141

.         .         .         .         .         .           g.47820
aatctggaatctccgtattctcccaaagaggagcacatctacaccaaaacttggattttg  c.880-1081

.         .         .         .         .         .           g.47880
ctttatttctatttctactttgctctgagcatcccttctgctgcacatctcagctctagt  c.880-1021

.         .         .         .         .         .           g.47940
caacttgatctgaggttgagaagcaggcaccgttggttctcagacccacggggtaataag  c.880-961

.         .         .         .         .         .           g.48000
ttgcatgtaatgtgggctcagcagggtgaaaaagcagttcagaatccttttagctggtgt  c.880-901

.         .         .         .         .         .           g.48060
taattcattttgcctcaagcacagcaagaggaaaaagtcatatgagtgattattgcacct  c.880-841

.         .         .         .         .         .           g.48120
tgatgacaagcccagacttctgttgtttgatcagaaattaggctgtccgtttgcagcaac  c.880-781

.         .         .         .         .         .           g.48180
atggatgcagctggaagccataatcctaagcaaattaatgcaggaatagaaaaccaactt  c.880-721

.         .         .         .         .         .           g.48240
ctgcatcttttcacttataagtgggagctaaacattgagcacccatggacataaacatga  c.880-661

.         .         .         .         .         .           g.48300
gaaaaatagacactggagactactagaagggggagggtgaaaaaactacctattggatac  c.880-601

.         .         .         .         .         .           g.48360
tatgctcgctacctgggtgatgggatcctgtattagtccattttcatactgctgtgaaga  c.880-541

.         .         .         .         .         .           g.48420
aatacccgagactgggtactttataaagaaaaaggggtttaacatatccacagttccaca  c.880-481

.         .         .         .         .         .           g.48480
tggctggggaggcctcacaatcatggtggaaggcgaaggaggagcaaaagcatgtcttac  c.880-421

.         .         .         .         .         .           g.48540
atggaggcaatcaagagagcatgtgttggggaactgccctttataaaaccatcagatctt  c.880-361

.         .         .         .         .         .           g.48600
gtgagacttattcactatcatgagaacagcatgggaaaaacctgcccccatgattcagtt  c.880-301

.         .         .         .         .         .           g.48660
acctcccaccgggtccttctcacaacatgtggggattatggaagctacaattcaggatga  c.880-241

.         .         .         .         .         .           g.48720
gatttgggtggggacacaaccaaaccatatcagatccctaccccaaacctcagtatcaca  c.880-181

.         .         .         .         .         .           g.48780
caatatacccatgtaacaaaactgcatatgtatccctctatctaaattaaaagttgaata  c.880-121

.         .         .         .         .         .           g.48840
aaaataaataaaaaaattagaatgtcacttgcaaacaccttcatgtatgcatgaaatgtg  c.880-61

.         .         .         .         .         .           g.48900
tgtcattgtccagtcacttcccttgcatcatgcgttcagtctctccttgtgtgttcacag  c.880-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center