homogentisate 1,2-dioxygenase (HGD) - 4617 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.54395
gtaagtatgttaactgccacattccagcggcctctgaactccccacccttactgagaggg  c.1188+60

         .         .         .         .         .         .  g.54455
gtggccgtttttcatttctccaaagtcacagaggaagagtcaaaagagggagagttaatg  c.1188+120

         .         .         .         .         .         .  g.54515
actgcataagtatgtttacatgtatatatactcacatccttgtgtatatactagacttct  c.1188+180

         .         .         .         .         .         .  g.54575
gttgtggtggtgtagaaagatcgttggacttggagtcagacctgggttctgagtttaagt  c.1188+240

         .         .         .         .         .         .  g.54635
cccatctcttagttcctacaggatcttgaacaactcacttagcttctctgtgcttcattt  c.1188+300

         .         .         .         .         .         .  g.54695
tccccatctataaaatgggtatagtatccaacccagcagatggctatgagttaacctaac  c.1188+360

         .         .         .         .         .         .  g.54755
agactgtccaacactattcaaatgtaagggaacattattaatactatgtgaagcctcttc  c.1188+420

         .         .         .         .         .         .  g.54815
ctgtatccttatgcagccctgggcatatgctatgtctcagagtcttctgcgttttgaagt  c.1188+480

         .         .         .         .         .         .  g.54875
aatcctccagggccacagtagtagcggaggcaggatctcaccttcagcacgtgtttcaag  c.1188+540

         .         .         .         .         .         .  g.54935
ccaaggagggtcaaaaagcccttgcctcactatagtcagggcttgtgagaagcaattctc  c.1188+600

         .         .         .         .         .         .  g.54995
agctgttttttgcattttcctttgctctgctttggcatggatgcaactgatgggatttaa  c.1188+660

         .         .         .         .         .         .  g.55055
aacctgttttgtattcttcctgtgtcaggctgtaaacattgaggctgaacacaattgcag  c.1188+720

         .         .         .         .         .         .  g.55115
ctggctgcggtgcttgattttattttatttttgcattcttcgaggtagagtttatggtcc  c.1188+780

         .         .         .         .         .         .  g.55175
acagggagtaattttatgctaaatcacatgcaaatttgctttacttttgaaaataaatgc  c.1188+840

         .         .         .         .         .         .  g.55235
cttcaatgctacctggtttaaaatctatagcagagacctgcctgcttcatgcttgcaaac  c.1188+900

         .         .         .         .         .         .  g.55295
tacctaaacagtgagcattatctgtccgtctgtccactgcagtttgctttcagtcccaac  c.1188+960

         .         .         .         .         .         .  g.55355
cctggagccagagttggtggagctcctttgcaaaaggagggtgttcagagtcccatttgc  c.1188+1020

         .         .         .         .         .         .  g.55415
ttgctttggctctatttcccctttcaagggcctctatggagtttctgtagaacccctaca  c.1188+1080

         .         .         .         .         .         .  g.55475
tctcaaagagatgcagtctggcagtctcagttaagctattacctctgaagtctcctggag  c.1188+1140

         .         .         .         .         .         .  g.55535
gtgcagtcctggaggctattctagagttgccactcaataacctttggtcccccaatttgg  c.1188+1200

         .         .         .         .         .         .  g.55595
ctttgggtagtcaatgttatgagggagctgtgttttacaacagtgaggcgtaggacaggg  c.1188+1260

         .         .         .         .         .         .  g.55655
ctgtttctatgaggagcaatactttgaattactagtgagaaagagctctcctattaggat  c.1188+1320

         .         .         .         .         .         .  g.55715
gggagaccctgggtatcaaggagccagaatacctgatggcggagggtccaacatcttacc  c.1188+1380

         .         .         .         .         .         .  g.55775
tagacctaactttcagtcgtcctcaccatttcccattatataattcagacccaggtctat  c.1188+1440

         .         .         .         .         .         .  g.55835
ctacatgccttatccttattcttgtttggagtgattaacttggtacaatagcatcttcaa  c.1188+1500

         .         .         .         .         .         .  g.55895
agtcagctgggatggggcttttgttaatccagccaaatggagaggcttttaagaagcagt  c.1188+1560

         .         .         .         .         .         .  g.55955
cagcaaagagacaatagcaatggccataatgatccttgtatgtgaatagtgctttttaaa  c.1188+1620

         .         .         .         .         .         .  g.56015
aatctttattacttattatttattatttttatggatacataataagtatgtatatttatg  c.1188+1680

         .         .         .         .         .         .  g.56075
gggtacatgagatatgatgatacaggcatatgatacgtaataatcacatcaagataaatg  c.1188+1740

         .         .         .         .         .         .  g.56135
gggtatccattacctcaagcatttatcctttgtgttacaaacaatccaattatattcttt  c.1188+1800

         .         .         .         .         .         .  g.56195
cagttattttaaaatgtgcaattaaatttttattgactatggtcaccctgttatgctatc  c.1188+1860

         .         .         .         .         .         .  g.56255
aaatgctaggtcttattcattttttttcttttatttctttatttatttttaacttttatt  c.1188+1920

         .         .         .         .         .         .  g.56315
tgaggttcaggggtacatgtgaagatttgttatataggtaaactgatgtcacaggggttt  c.1188+1980

         .         .         .         .         .         .  g.56375
attgtacagattatttcatcactcgggtactaaacagtacccaatagttattttttctga  c.1188+2040

         .         .         .         .         .         .  g.56435
ttctctccctcctcccaccctctattctcaagtaggcatcagtgtctgttgctcccctct  c.1188+2100

         .         .         .         .         .         .  g.56495
ttgtgtccacaagttctcatcatttagctcccatttagaagtgagaacatacaatatttg  c.1188+2160

         .         .         .         .         .         .  g.56555
gttttctgttcctcttagtttgccaaggataatggcctccagctccgtcgtgttcctgag  c.1188+2220

         .         .         .         .         .         .  g.56615
aaacacatgatcttgttcttttttatggctgcatagtattccattatctgtgtgtgtgtg  c.1188+2280

         .         .           g.56644
tgtgtgtgtgtgtgtgtgtgtgtatgtgt  c.1188+2309

--------------------- middle of intron ---------------------
                   g.56645              .         .           g.56672
                   c.1189-2308  gtgtgtatgtgtatatatatatatatat  c.1189-2281

.         .         .         .         .         .           g.56732
atatatatataaagctcttaagtttaattagatccatttgtcaatttttcttttgttgcc  c.1189-2221

.         .         .         .         .         .           g.56792
aattgcttttgatgtttttgtcatgaaatctttgcccatgctgatgtcctgaatggtatt  c.1189-2161

.         .         .         .         .         .           g.56852
gcctaggtcatcttccagagtttttatagttttgggcttaacatttaagtccttaatcca  c.1189-2101

.         .         .         .         .         .           g.56912
tcatgagttggtttttctatatggtgtatggaagcggtccagtttaaatcttctgcttat  c.1189-2041

.         .         .         .         .         .           g.56972
gactagccagttgtcccagcatgatttattgaatagatagtcctttccccattgcttgtt  c.1189-1981

.         .         .         .         .         .           g.57032
tttgtcagcttcattgaaaatcggatggttataggtgtgcggccttgtttctgggctctc  c.1189-1921

.         .         .         .         .         .           g.57092
tattctgttccattggtctatgtgcctgtttctgtatcattaccacactgttttggttac  c.1189-1861

.         .         .         .         .         .           g.57152
tgtagccttgtagtatactttgaagttgggtagcatgatgcctcctgctttgttcttttt  c.1189-1801

.         .         .         .         .         .           g.57212
gcttaggatagccttgggtatttgggctcttttttggttccatatgaattttaaaatagt  c.1189-1741

.         .         .         .         .         .           g.57272
ctttcctagttctgtgaagaatgtcgttggtattttgatatgaacagcgttgaatcttta  c.1189-1681

.         .         .         .         .         .           g.57332
cattgctttggatagtatcgtcatcttaatgatgttgattcttcctacccatgagcatgg  c.1189-1621

.         .         .         .         .         .           g.57392
aaagtttttccatttgtttgtgtcttctctgatttctttgagcagtgttttgtaattctc  c.1189-1561

.         .         .         .         .         .           g.57452
attatagagacctttcacctctctggttaggggtattcctaggtattttattctttttgt  c.1189-1501

.         .         .         .         .         .           g.57512
ggcagttgtgaatgggattgcattcctgatttggctttcagcttgactgttgttggtgta  c.1189-1441

.         .         .         .         .         .           g.57572
taggaatgctagtgatttttgtacattgattttgtatcatgaactttgctgaaagttgtt  c.1189-1381

.         .         .         .         .         .           g.57632
tattggttgaaggagcttttgggctgagactatggtgttttctagatatagaatcaggtc  c.1189-1321

.         .         .         .         .         .           g.57692
atctgcaaacagggataggttgacttcttctcttctggatgcactttatttctttctatt  c.1189-1261

.         .         .         .         .         .           g.57752
gcctgattactctttgccacgacttctaagactatgttgaataggagtggtgagagagag  c.1189-1201

.         .         .         .         .         .           g.57812
catccttgtcttatgctggttttcaaagggaatgcttccagcttttccccattcagtatg  c.1189-1141

.         .         .         .         .         .           g.57872
atgttggctgtgggtttgtcataggtggctcttattattctgtgatgtgttccttcaatg  c.1189-1081

.         .         .         .         .         .           g.57932
cctagtttattgagagtttttaacttgaagatatactgaattttattgaaagccttttct  c.1189-1021

.         .         .         .         .         .           g.57992
gcatcttgaatagcactgtataacttgcatagcacttccatatgatctcatccagtcttc  c.1189-961

.         .         .         .         .         .           g.58052
ccatcaagcctgtcacaggaaatcaggcagcgatactcatatccattgttttagacaaaa  c.1189-901

.         .         .         .         .         .           g.58112
ataatttaatgtatattagagcccaaacattaatgtgggtgctttgggttgtagcacaag  c.1189-841

.         .         .         .         .         .           g.58172
ataattctattattttccttttgcctgtctgtattatacaaatttccaaatgtgagcata  c.1189-781

.         .         .         .         .         .           g.58232
taagaattgtagggtttggtttttgggttttgttttgtttttaaagccacagtggataag  c.1189-721

.         .         .         .         .         .           g.58292
aaaagtcagcaattgatgaagctgtaatgtctaagatgcacagagtatttacatattctt  c.1189-661

.         .         .         .         .         .           g.58352
tctgttgtggacaaaaacctcctgacagtgcaacatccaccattcagacacttctgagat  c.1189-601

.         .         .         .         .         .           g.58412
atgacttttaaaagtgctacagccattcctgccatttccttcacctccctctcctcccca  c.1189-541

.         .         .         .         .         .           g.58472
ctccctttttcccttttcccagcccatctcttggtcagagtcctgaaaagacaggctcaa  c.1189-481

.         .         .         .         .         .           g.58532
atcccagttctgcgatgacttgtcgccttaagcaagtcgtttcccagctctcagccttaa  c.1189-421

.         .         .         .         .         .           g.58592
ttcctcctctgcaaaatgggaagtatgactttcctcacaaggacatagccacagtaagtg  c.1189-361

.         .         .         .         .         .           g.58652
aaggccctcagaagatggatattcccaggattctcccatgtctgcccttggatctagcag  c.1189-301

.         .         .         .         .         .           g.58712
acttagttccgtaataccatgaagataatttgaagcttaagggctgaattttattttaca  c.1189-241

.         .         .         .         .         .           g.58772
gaatgaaacttgaggccctgagaagttaagggtcttgtaccaggtctcaccagcttacaa  c.1189-181

.         .         .         .         .         .           g.58832
atggtaggaccagagccacaactcagggcttgagcctgctctcctcaccactctagcaca  c.1189-121

.         .         .         .         .         .           g.58892
caaatctttgatttgttattggaagatttcacctacccataccttctgttgacatctaat  c.1189-61

.         .         .         .         .         .           g.58952
caaatgtgtttattatctatctcacctcttttttctcatccccatcgtcacttcctccag  c.1189-1


Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center