homogentisate 1,2-dioxygenase (HGD) - coding DNA reference sequence

(used for mutation description)

(last modified January 20, 2011)


This file was created to facilitate the description of sequence variants in the HGD gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011957.1, covering HGD transcript NM_000187.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                     .         .         .         .                g.4950
                     ctccaggagactcagcactgccctgttccttcctagcctg       c.-421

 .         .         .         .         .         .                g.5010
 agtcaggactgagcagagaatcctccaccacacacagcaggcactatctgccacagttcc       c.-361

 .         .         .         .         .         .                g.5070
 tttccccgatagcttcaaattctctgccttttgaaataagcctacttttaactggaataa       c.-301

 .         .         .         .         .         .                g.5130
 ataattggtcaatctctacctcaggtgaagaggaaccaagcctctggaaacacttaggaa       c.-241

 .         .         .         .         .         .                g.5190
 caaactgtaaaaaccaaaggcaattgtgtaaccggttaaataagcttgctggactttgtc       c.-181

 .         .         .         .         .         .                g.5250
 cctgtgtatgagttagacaattctttcagctagtttgagtgacgcactgaccagtgaagc       c.-121

 .         .         .         .         .         .                g.5310
 gcagtgaagcagtgggaaccggaatatccaaagagtggtttgaaggagaaagaagcattg       c.-61

 .         .         .         .         .         .                g.5370
 tggctttatatcctctgggcctgggtttcctgaagtcaccacacatagaggagagagaaa       c.-1

          .      | 02  .         .         .         .         .    g.11663
 ATGGCTGAGTTAAAG | TACATTTCTGGATTTGGGAATGAGTGTTCTTCAGAGGATCCTCGC    c.60
 M  A  E  L  K   | Y  I  S  G  F  G  N  E  C  S  S  E  D  P  R      p.20

          .         .        | 03.         .         .         .    g.12525
 TGCCCAGGTTCCCTGCCAGAAGGACAG | AATAATCCTCAGGTCTGCCCCTACAATCTCTAT    c.120
 C  P  G  S  L  P  E  G  Q   | N  N  P  Q  V  C  P  Y  N  L  Y      p.40

          .         .         .         .         .       | 04 .    g.16953
 GCTGAGCAGCTCTCAGGATCGGCTTTCACTTGTCCACGGAGCACCAATAAGAGAAG | CTGG    c.180
 A  E  Q  L  S  G  S  A  F  T  C  P  R  S  T  N  K  R  S  |  W      p.60

          .         .         .         .         .         .       g.17013
 CTGTATAGGATTCTACCTTCAGTTTCTCACAAGCCCTTTGAATCCATTGACGAAGGCCAA       c.240
 L  Y  R  I  L  P  S  V  S  H  K  P  F  E  S  I  D  E  G  Q         p.80

          .         .         .         .   | 05     .         .    g.34848
 GTCACTCACAACTGGGATGAAGTTGATCCTGATCCTAACCAG | CTTAGATGGAAACCATTT    c.300
 V  T  H  N  W  D  E  V  D  P  D  P  N  Q   | L  R  W  K  P  F      p.100

          .         .         .         .   | 06     .         .    g.36634
 GAGATTCCAAAAGCATCTCAGAAGAAAGTAGACTTTGTGAGT | GGCCTGCATACCTTGTGT    c.360
 E  I  P  K  A  S  Q  K  K  V  D  F  V  S   | G  L  H  T  L  C      p.120

          .         .         .         .         .         .       g.36694
 GGAGCTGGAGACATAAAGTCTAACAATGGGCTTGCTATCCACATTTTCCTCTGCAATACC       c.420
 G  A  G  D  I  K  S  N  N  G  L  A  I  H  I  F  L  C  N  T         p.140

          .     | 07   .         .         .          | 08        . g.40440
 TCCATGGAGAACAG | ATGCTTTTACAATTCAGATGGGGACTTCTTGATTG | TTCCGCAGAAA c.480
 S  M  E  N  R  |  C  F  Y  N  S  D  G  D  F  L  I  V |   P  Q  K   p.160

          .         .         .         .         .         .       g.40500
 GGGAACCTTCTCATTTACACCGAGTTTGGCAAGATGCTTGTACAGCCCAATGAGATCTGC       c.540
 G  N  L  L  I  Y  T  E  F  G  K  M  L  V  Q  P  N  E  I  C         p.180

           | 09        .         .         .         .         .    g.41166
 GTCATTCAG | AGAGGAATGCGGTTCAGCATAGATGTCTTTGAGGAGACCAGGGGCTACATC    c.600
 V  I  Q   | R  G  M  R  F  S  I  D  V  F  E  E  T  R  G  Y  I      p.200

          .         .         .         .          | 10        .    g.43049
 TTGGAGGTCTATGGTGTCCACTTTGAGTTACCTGACCTTGGACCAATTG | GGGCCAATGGC    c.660
 L  E  V  Y  G  V  H  F  E  L  P  D  L  G  P  I  G |   A  N  G      p.220

          .         .         .         .         .         .       g.43109
 TTGGCCAATCCTCGTGATTTCTTGATACCCATTGCCTGGTATGAGGATCGCCAAGTACCA       c.720
 L  A  N  P  R  D  F  L  I  P  I  A  W  Y  E  D  R  Q  V  P         p.240

          .         .         .         .         .     | 11   .    g.45794
 GGTGGTTACACGGTCATTAATAAATACCAGGGCAAGCTGTTTGCTGCCAAACAG | GATGTC    c.780
 G  G  Y  T  V  I  N  K  Y  Q  G  K  L  F  A  A  K  Q   | D  V      p.260

          .         .         .         .         .         .       g.45854
 TCCCCGTTCAATGTTGTGGCCTGGCACGGGAATTATACACCCTACAAGTACAACCTGAAG       c.840
 S  P  F  N  V  V  A  W  H  G  N  Y  T  P  Y  K  Y  N  L  K         p.280

          .         .         .          | 12        .         .    g.48921
 AATTTCATGGTTATCAACTCAGTGGCCTTTGACCATGCA | GACCCATCCATTTTCACAGTA    c.900
 N  F  M  V  I  N  S  V  A  F  D  H  A   | D  P  S  I  F  T  V      p.300

          .         .         .         .         .         .       g.48981
 TTGACTGCTAAGTCTGTCCGCCCTGGAGTGGCCATTGCTGATTTTGTCATCTTCCCACCT       c.960
 L  T  A  K  S  V  R  P  G  V  A  I  A  D  F  V  I  F  P  P         p.320

          .         .         .         .       | 13 .         .    g.54167
 CGATGGGGGGTTGCTGATAAGACCTTCAGGCCTCCTTATTACCATA | GGAACTGCATGAGT    c.1020
 R  W  G  V  A  D  K  T  F  R  P  P  Y  Y  H  R |   N  C  M  S      p.340

          .         .         .         .         .         .       g.54227
 GAGTTCATGGGACTCATCCGAGGTCACTATGAGGCAAAGCAAGGTGGGTTCCTGCCAGGG       c.1080
 E  F  M  G  L  I  R  G  H  Y  E  A  K  Q  G  G  F  L  P  G         p.360

          .         .         .         .         .         .       g.54287
 GGAGGGAGTCTACACAGCACAATGACCCCCCATGGACCTGATGCTGACTGCTTTGAGAAG       c.1140
 G  G  S  L  H  S  T  M  T  P  H  G  P  D  A  D  C  F  E  K         p.380

          .         .         .         .         | 14         .    g.58964
 GCCAGCAAGGTCAAGCTGGCACCTGAGAGGATTGCCGATGGCACCATG | GCATTTATGTTT    c.1200
 A  S  K  V  K  L  A  P  E  R  I  A  D  G  T  M   | A  F  M  F      p.400

          .         .         .         .         .         .       g.59024
 GAATCATCTTTAAGTCTGGCGGTCACAAAGTGGGGACTCAAGGCCTCCAGGTGTTTGGAT       c.1260
 E  S  S  L  S  L  A  V  T  K  W  G  L  K  A  S  R  C  L  D         p.420

          .         .         .         .         .         .       g.59084
 GAGAACTACCACAAGTGCTGGGAGCCACTCAAGAGCCACTTCACTCCCAACTCCAGGAAC       c.1320
 E  N  Y  H  K  C  W  E  P  L  K  S  H  F  T  P  N  S  R  N         p.440

          .                                                         g.59102
 CCAGCAGAACCTAATTGA                                                 c.1338
 P  A  E  P  N  X                                                   p.445

          .         .         .         .         .         .       g.59162
 gactggaacattgctaccataattaagagtagatttgtgaagatttcttcagaatctcat       c.*60

          .         .         .         .         .         .       g.59222
 gctttctggtagtattggaggagggggttggttaaaatgaaaattcacttttcatagtca       c.*120

          .         .         .         .         .         .       g.59282
 agtaactcagaacttttatggaaacgcatttgcaaagttctatggctgtcaccttaatta       c.*180

          .         .         .                                     g.59314
 ctcaataaacttgctggtgttctgtggacgta                                   c.*212

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Homogentisate 1,2-dioxygenase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.2.0 Build 28
©2004-2011 Leiden University Medical Center